FiltersDone

Question type

Essay

Multiple Choice

Short Answer

True False

Matching

Exam 17: Genomes

Show Answer

Share

---

All types

Filters

Study FlashcardsPractice ExamLearn

Question 111

Short Answer

Review LaterAdd Note

Review Later

The genes that encode estrogen receptors and those that encode adrenal steroid receptors evolved from an ancestral gene hundreds of millions of years ago.These genes are an example of a gene _______.

Correct Answer

verified

Show Answer

Question 112

Multiple Choice

Review LaterAdd Note

Review Later

Craig Venter's team determined essential genes in bacteria by

A) knocking genes out with transposons; if bacteria survived despite the gene being knocked out, then the gene was an essential gene.
B) adding genes one by one to a bacterium without genes and seeing when the bacterium could survive.
C) knocking genes out with X rays; if bacteria survived despite the gene being knocked out, then the gene was an essential gene.
D) knocking genes out with X rays; if bacteria could not survive despite the gene being knocked out, then the gene was an essential gene.
E) knocking genes out with transposons; if bacteria could not survive when the gene was knocked out, then the gene was an essential gene.

F) A) and B)
G) B) and E)

Correct Answer

verified

Show Answer

Question 113

Multiple Choice

Review LaterAdd Note

A group of biologists is studying the link between genetic variation and variation in response to statin drugs in a group of people with heart disease.This activity is best described as

It is the year 2025.You are taking care of a patient who is concerned about having an early stage of kidney cancer.His mother died from this disease.How might you develop a metabolomic profile for kidney cancer and then use it to determine whether your patient has kidney cancer?

A biologist is interested in the genomics of organisms that undergo complex transitions during development.She wants an animal with a genome that is smaller than 500 million nucleotides._______ would be a useful model organism.

The fluorescent dye attached to dNTPs in DNA sequencing

Five prokaryote species (labeled A-E) have been sequenced.Refer to the table with the findings of the genes they contain.(Note: "x" denotes the species possessing a functional copy of the gene.) Gene 1 is essential for the synthesis of several amino acids.Gene 2 encodes a protein involved in strengthening the cell wall.Gene 3 appears to encode an enzyme, but its function is unknown. One way to obtain clues about the function of gene 3 would be to see what substances species _______ cannot grow on, in contrast with the other species.

Nonfunctional copies of genes, known as _______, arise when mutations knock out the function of a gene.

Refer to the figure showing the use of transposons as mutagens in Mycoplasma genitalium. The transposon mutagenesis procedure shown in the figure

Which procedure is not used in high-throughput DNA sequencing?

The most likely reason why the plant Arabidopsis thaliana has more protein-coding genes than flies or nematodes have is that

Five prokaryote species (labeled A-E) have been sequenced.Below are the findings of the genes they contain.(Note: "x" denotes the species possessing a functional copy of the gene.) Gene 1 is essential for the synthesis of several amino acids.Gene 2 encodes a protein involved in strengthening the cell wall.The functions of the other genes are currently unknown. Which species would most likely have difficulty growing on a growth medium composed simply of a sugar as a carbon source?

Which statement comparing the human genome to those of invertebrates such as Caenorhabditis elegans and Drosophila melanogaster is true?

Refer to the table showing a hypothetical data set comparing the gene content of strains of Salmonella and Shigella (which are all pathogenic) and pathogenic and nonpathogenic strains of E.coli.(Note: "x" denotes presence of the gene.) What is the most likely conclusion about gene C?

Overlapping reads in high-throughput sequencing are possible because

Below are four overlapping reads from sequencing.(Note: All reads are in a 5′-to-3′ direction.) Read 1: AGCGCTAAAGACGGCTCGAGTCAGCTAGTAGAA Read 2: TGCGTAGCTATCGCATACGCAAGCGCTAAA Read 3: GCTAGTAGAATCGATATCGAGGATCGATTAG Read 4: GGATCGATTAGAGCTATAGTAGGCTGATGAC Which is the most likely order of these reads?

The transposable element bandit, which was discovered in the dog hookworm, appears able to move to the hookworm's mammalian hosts.Because it does not use an RNA intermediate, the bandit element has been classified as a(n) _______.

An organism has a genome that is 2.7 million bp long, with only 12 percent noncoding sequence.It lacks introns, except in its tRNA and rRNA.This organism is most likely a prokaryotic organism and is a(n) _______.

A highly repetitive sequence is found in a eukaryotic genome.Its repeat length is short, and the repeats are found next to one another.It is also not transcribed.This is most likely composed of _______.

A universal adapter used in a DNA sequencing run starts 5′-TGCAGTA….What would be the sequence of the corresponding universal primer? (Note: "…" represents many nucleotides.)