Question 1

p53 is a tumor suppressor gene that acts as a sensor of DNA damage.

Accepted Answer

A) True 
 B)False

Question 2

Which of the following types of physical mutagens produces thymine dimer mutations?

Accepted Answer

A)  ultraviolet light
B)  X-rays
C)  microwave
D)  gamma rays
E)  ionizing radiationF) None of the above
G) A) and C)

Question 3

Women are cautioned against having children later in life because the incidence of Down syndrome (trisomy 21) increases rapidly with age.What is the best explanation for this phenomenon?

Accepted Answer

A)  Somatic mutations accumulate as a woman gets older,leading to changes in the uterine environment that cause down syndrome.
B)  Germ line mutations accumulate as a woman ages,so a larger percentage of her eggs have mutations.
C)  Germ line mutations accumulate as a woman gets older,leading to changes in the uterine environment that cause down syndrome.
D)  Somatic mutations accumulate as a woman ages,so a larger percentage of her eggs have mutations.
E)  Somatic mutations accumulate as a woman ages,so the developing embryo is more likely to acquire mutations that lead to down syndromE.F) A) and C)
G) C) and E)

Question 4

Most oncogenes encode proteins that function in cell growth signaling pathways.

Accepted Answer

A) True 
 B)False

Question 5

Which of the following base pairs would be targeted and repaired by a mismatch repair system?

Accepted Answer

A)  A -T
B)  C-G
C)  A-G
D)  A-G and C-G
E)  A-T and C-GF) B) and E)
G) D) and E)

Question 6

Based on the gene and protein sequences that follow,what type of mutation has occurred and what is its effect on the polypeptide?
Normal gene: ATGGCCGGCCCGAAAGAGACC
Mutated gene: ATGGCCGGCACCGAAAGAGACC
Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr
Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp

Accepted Answer

A)  base addition - silent
B)  substitution - misense
C)  base addition - missense
D)  substitution - frameshift
E)  base addition - frameshiftF) None of the above
G) A) and E)

Question 7

When cancer cells have the ability to migrate to other parts of the body,they are said to be

Accepted Answer

A)  invasive.
B)  benign.
C)  metastatiC.
D)  oncogenic.
E)  genetic.F) A) and B)
G) D) and E)

Question 8

Which of the following would occur from a mutation in the gene's promoter region?

Accepted Answer

A)  The sequence of the mature mRNA would change.
B)  The ability of pre-mRNA to be properly spliced would change.
C)  The ability of mRNA to be translationally regulated would change.
D)  The amino acid sequence of the translated protein would be altereD.
E)  The rate of transcription may increase or decreasE.F) All of the above
G) C) and E)

Exam 12: Mutation, DNA Repair, and Cancer

Which of the following base pairs would be targeted and repaired by a mismatch repair system?

Correct Answer
verified

Most oncogenes encode proteins that function in cell growth signaling pathways.

Correct Answer
verified

p53 is a tumor suppressor gene that acts as a sensor of DNA damage.

Correct Answer
verified

Which of the following types of physical mutagens produces thymine dimer mutations?

Correct Answer
verified

Women are cautioned against having children later in life because the incidence of Down syndrome (trisomy 21) increases rapidly with age.What is the best explanation for this phenomenon?

Correct Answer
verified

When cancer cells have the ability to migrate to other parts of the body,they are said to be

Correct Answer
verified

Based on the gene and protein sequences that follow,what type of mutation has occurred and what is its effect on the polypeptide? Normal gene: ATGGCCGGCCCGAAAGAGACC Mutated gene: ATGGCCGGCACCGAAAGAGACC Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp

Correct Answer
verified

Which of the following would occur from a mutation in the gene's promoter region?

Correct Answer
verified

Exam 12: Mutation, DNA Repair, and Cancer

Which of the following base pairs would be targeted and repaired by a mismatch repair system?

Correct AnswerverifiedShow Answer

Most oncogenes encode proteins that function in cell growth signaling pathways.

Correct AnswerverifiedShow Answer

p53 is a tumor suppressor gene that acts as a sensor of DNA damage.

Correct AnswerverifiedShow Answer

Which of the following types of physical mutagens produces thymine dimer mutations?

Correct AnswerverifiedShow Answer

Women are cautioned against having children later in life because the incidence of Down syndrome (trisomy 21) increases rapidly with age.What is the best explanation for this phenomenon?

Correct AnswerverifiedShow Answer

When cancer cells have the ability to migrate to other parts of the body,they are said to be

Correct AnswerverifiedShow Answer

Based on the gene and protein sequences that follow,what type of mutation has occurred and what is its effect on the polypeptide? Normal gene: ATGGCCGGCCCGAAAGAGACC Mutated gene: ATGGCCGGCACCGAAAGAGACC Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp

Correct AnswerverifiedShow Answer

Which of the following would occur from a mutation in the gene's promoter region?

Correct AnswerverifiedShow Answer

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified